Characteristics of polymorphic markers for Juniperus communis L. from Lithuania

Abstract

Application of molecular markers has been developed rapidly over the last two decades. DNA based markers, such as microsatellites (SSR) are very powerful tools for the analysis of genetic biodiversity due to their high level of polymorphism, frequency distribution in the eukaryotic genome, co-dominant patterns of inheritance and have a high discrimination power. Studies of common juniper based on the molecular markers included analysis of plants growing in Southern and Western parts of Europe. However, not enough attention has been paid consider the importance of genetic diversity of common juniper in more Eastern and Northern parts of Europe. J. communis is the third common species among conifers naturally growing in Lithuania. In this country J. communis is important component of forest ecosystems also is widely used in the pharmaceutical, spicy, ornamental and fragrant plant. Our study aimed at evaluation of polymorphic SSR loci of Lithuania populations of common juniper from different geographic regions and habitat types. Samples were collected from 14 population (140 juniper individuals in total) of J. communis belonging to 5 different habitat types: coastal brown dunes covered with natural coniferous forest (Pinus sylvestris); Juniperus communis scrubs; subcontinental moss; scots pine forests; transition mires and quaking bogs, xero-thermophile fringes. Genomic DNA was extracted from current-year needles using CTAB method. Five pairs of SSR primers were tested: Jc016 (forward − F: CAAAATGATGCTTATGATGA; reverse − R: TGAAAATCATTGTTGTTTTCTT), Jc031 (F: CCTAATGTTGTAATCACGTATATCT; R: TGACCTTGGGCGTATAGATT), Jc032 (F: ACATTGCAAATATGGGGTAA; R: TTGATGAGTTGTTGAGTTATTAAG), Jc035 (F: TGTGTTT ATTCTCCCCATCT; R: CCCCCAGTTATTCTAAACATT); Jc037 (F: GGCAATTAGTAA GGCACAAG; R: TAAGGTGGATATCACCAAGG). All primers have generated DNA fragments of J. communis after optimization PCR. [...].